View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_high_12 (Length: 346)
Name: NF19349_high_12
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 19 - 333
Target Start/End: Complemental strand, 49584804 - 49584490
Alignment:
| Q |
19 |
accactaccagaaccttccactttacgacacacatgtcgtgaaggttttgatactaaacagtcctcctgacttctgttgcgcttctttttgtctagatat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584804 |
accactaccagaaccttccactttacgacacacatgtcgtgaaggttttgatactaaacagtcctcctgacttctgttgcgcttctttttgtctagatat |
49584705 |
T |
 |
| Q |
119 |
ccaaatgcgaaagcctccggaactttctcccgaggtggaattaccgttgcatttttctctagatcaatgagctcaggattggacgcaactttattgagga |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584704 |
ccaaatgcaaaagcctccggaactttctcccgaggtggaattaccgttgcatttttctctagatcaatgagctcaggattggacgcaactttattgagga |
49584605 |
T |
 |
| Q |
219 |
tttcaaacggagaatcgaaatattgtacccccttcagcagattcctcgaaaactgtttaactcgagggacaaggaagaccatagaattcttacaaggaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584604 |
tttcaaacggagaatcgaaatattgtacccccttcagcagattccttgaaaactgtttaactcgggggacaaggaagaccatagaattcttacaaggaac |
49584505 |
T |
 |
| Q |
319 |
ataattataacatct |
333 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49584504 |
ataattataacatct |
49584490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University