View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_high_15 (Length: 326)
Name: NF19349_high_15
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 27098999 - 27099316
Alignment:
| Q |
1 |
tccactacctcctccaccggaatattccatcatctgatccgacattgcagcagccgcggcactctcccttgtgatcgcggttattttgcggtggaagttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098999 |
tccactacctcctccaccggaatattccatcatctgatccgacattgcagcagccgcggcactctcccttgtgatcgcggttattttgcggtggaagttc |
27099098 |
T |
 |
| Q |
101 |
cggtgacagccgcaggctgcacattggaggctgtttaccgcggatggcgatgagtcatcgatggtgaattcaccgcagccgtcggtggcgtagcttccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099099 |
cggtgacagccgcaggctgcacattggaggctgtttaccgcggatggcgatgagtcgtcgatggtgaattcaccgcagccgtcggtggcgtagcttccaa |
27099198 |
T |
 |
| Q |
201 |
ggcttgctgcatggtttcttaaacactctctgtagatatagttttgtgaatgtgatgatgaagatgataacattcctcctccttccattgtttttattta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099199 |
ggcttgctgcatggtttcttaaacactctctgtagatatagttttgtgaatgtgatgatgaagatgataacattcctcctccttccattgtttttattta |
27099298 |
T |
 |
| Q |
301 |
ttattttctctctctctg |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27099299 |
ttattttctctctctctg |
27099316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University