View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_high_16 (Length: 320)
Name: NF19349_high_16
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 29456353 - 29456148
Alignment:
| Q |
13 |
aatatgaaaaagaaacatgtaaattgacaagcatctactctcatttttaggggggattttattttagataaaagcaaaaaataaaacatgtatgttgacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29456353 |
aatatgaaaaagaaacatgtaaattgacaagcatctactctcatttttaggggggattttattttagataaaagcaaaaaataaaaa---tatgttgacc |
29456257 |
T |
|
| Q |
113 |
attagtcgaattacaaatttgattcttttttcatatgtaagcaaataattaaaatatatttttaatatcatacattgtcaacatatacttgttataaacc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456256 |
attagtcgaattacaaatttgattcttttttcatatgtaagcaaataattaaaatatatttttaatatcatacattgtcaacatatacttgttataaact |
29456157 |
T |
|
| Q |
213 |
tggcatttt |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
29456156 |
tggcatttt |
29456148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 29456134 - 29456090
Alignment:
| Q |
239 |
cttggcatagaagtgtaccctaaaaagttaaatcatcctaggaaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
29456134 |
cttggcatagaagtgtaccctaaaaagttaaatcattcgaggaaa |
29456090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University