View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_high_22 (Length: 249)
Name: NF19349_high_22
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_high_22 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 33 - 249
Target Start/End: Complemental strand, 2757279 - 2757063
Alignment:
| Q |
33 |
tttttatttttatgaaatcttagcgcgtaagattttgaacttatagtaaaaatttgtctttgtataaaaaataaattaatggattttgtctttatttgag |
132 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757279 |
tttttatttttataaaatcttagcgcgtaagattttgaacttatagtaaaaatttgtctttgtataaaaaataaattaatggattttgtctttatttgag |
2757180 |
T |
 |
| Q |
133 |
ttgtatcaattaatgtaagtaagtactatatcaagaaattttttcctcnnnnnnncttttttgactacaaaatggaccaatcacttgtattatataaagt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757179 |
ttgtatcaattaatgtaagtaagtactatatcaagaaattttttcctcaaaaaaacttttttgactacaaaatggaccaatcacttgtattatataaagt |
2757080 |
T |
 |
| Q |
233 |
tagattaattggacgaa |
249 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2757079 |
tagattaattggacgaa |
2757063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 2757306 - 2757278
Alignment:
| Q |
15 |
aaatgaaagtatggaaactttttattttt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2757306 |
aaatgaaagtatggaaactttttattttt |
2757278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University