View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_low_2 (Length: 555)
Name: NF19349_low_2
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 127 - 348
Target Start/End: Complemental strand, 45510202 - 45509981
Alignment:
| Q |
127 |
cctgattgggctaaggttgatgaggaagaggttgaggatttgtatgaggatgatgagtctgagaagaaagatgagaaggagttttattgtgtgttgtgtg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45510202 |
cctgattgggctaaggttgatgaggaagaggttgaggatttgtacgaggatgatgagtctgagaagaaagatgagaaggagttttattgtgtgttgtgtg |
45510103 |
T |
 |
| Q |
227 |
ggaagaagtttaagagtgagaagcaatggaagaatcatgagcagagtaagaagcataaggagaaagttgccgagttcaaggattcacttgatgatgaaga |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45510102 |
ggaagaagtttaagagtgagaagcaatggaagaatcatgagcagagtaagaagcataaggagaaagttgccgagttcaaggattcacttgatgatgaaga |
45510003 |
T |
 |
| Q |
327 |
ggagttagaagctgaggtggat |
348 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45510002 |
ggagttagaagctgaggtggat |
45509981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 413 - 485
Target Start/End: Complemental strand, 45509916 - 45509844
Alignment:
| Q |
413 |
ttagggttgatgatttggaggagaggattcgagacagtcttaatgttgcagatgaggagagtgcaaatggggt |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45509916 |
ttagggttgatgatttggaggagaggattcgagacagtcttaatgttgcagatgaggagagtgcaaatggggt |
45509844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University