View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_low_22 (Length: 251)
Name: NF19349_low_22
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 49755609 - 49755364
Alignment:
| Q |
1 |
aactcggttccaacgaacgacgaagagtcatgatgttgtggaagagtggaccgagaagggagatagtggaagaagaaagtggaaattgctattccaatga |
100 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755609 |
aactccgttccaacgaacgaagaagagtcatgatgttgtggaagagtggatcgagaagggagatagtggaagaagaaagtggaaattgctattccaatga |
49755510 |
T |
 |
| Q |
101 |
gaaggaaagggactcgatttagaagca---------tgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggtttgatctct |
191 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755509 |
gaaggaaagggactcgatttagaagcatgttgatgatgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggtttgatctct |
49755410 |
T |
 |
| Q |
192 |
tgtttggtttctgtgaattagttcagagctcattttgtttttgtat |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49755409 |
tgtttggtttctgtgaattagttcagaactcattttgtttttgtat |
49755364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University