View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_low_27 (Length: 236)
Name: NF19349_low_27
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 110 - 235
Target Start/End: Complemental strand, 8229096 - 8228971
Alignment:
| Q |
110 |
atcttttctaatctacccttattccaaattagcattgtatatacactattatcctcaaataggatcgttgcaatcatttttgtataagacaaaccatgta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8229096 |
atcttttctaatctacccttattccaaattagcattgtatatacactattatcctcaaataggatcgttgcaatcatttttgtataagacaaaccatgta |
8228997 |
T |
 |
| Q |
210 |
tttaatgagaccagagcttgcaacag |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8228996 |
tttaatgagaccagagcttgcaacag |
8228971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 8229256 - 8229170
Alignment:
| Q |
1 |
taaagaaatcaatttttgtgctagttgtttacacttgatagtgattttgtaaaaatagattattgcgactttgttgaaatatatata |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8229256 |
taaagaaatcaatttttgtgctagttgtttacacttgatagtgattttgtaaaaatagattattgcgactttgttgaatgatatata |
8229170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University