View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_low_29 (Length: 223)
Name: NF19349_low_29
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 36672669 - 36672873
Alignment:
| Q |
1 |
aagttattagcatgtcttgatggccatgtaattgattctttaggtgcattttgcagaatcaagtaactttgacttttaaaaacatattaatcgagctttc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36672669 |
aagtaattagcatgtcttgatggccatgtaattgattctttaggtgcattttgcagaatcaagtaactttgacttttaaaaacatattaatcgagctttc |
36672768 |
T |
 |
| Q |
101 |
aaaaatgttttcgctatggtaggtattagaaataggtaaagacttcaaagaaaagagaaaaattggtaacataaccttaacagttcttacgactgccgcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36672769 |
aaaaatgttttcgctatggtaggtattagaaataggtaaagacttcaaagaaaagagaaaaattggtaacataaccttaacagttcttacgactgccgcg |
36672868 |
T |
 |
| Q |
201 |
caata |
205 |
Q |
| |
|
||||| |
|
|
| T |
36672869 |
caata |
36672873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 105
Target Start/End: Original strand, 36683155 - 36683224
Alignment:
| Q |
36 |
ttctttaggtgcattttgcagaatcaagtaactttgacttttaaaaacatattaatcgagctttcaaaaa |
105 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||| ||||| ||||||| |||||||| ||||| |
|
|
| T |
36683155 |
ttctttaggtgcattttgcaaaagtaagtaactctgactttcaaaaatatattaaacgagctttgaaaaa |
36683224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 61 - 99
Target Start/End: Original strand, 56462376 - 56462414
Alignment:
| Q |
61 |
aagtaactttgacttttaaaaacatattaatcgagcttt |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
56462376 |
aagtaactttgacttttaaaaatatattaatcgagcttt |
56462414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University