View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_low_30 (Length: 208)
Name: NF19349_low_30
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 45 - 186
Target Start/End: Complemental strand, 11817238 - 11817097
Alignment:
| Q |
45 |
aacaagtggattccaccaataagtcccactaaactttcacttggtagataaacatagcaaactcaaactcattttaggaaaatcaagggtgcaaatagca |
144 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11817238 |
aacaagtggattccacaaataagtcccactaaactttcacttggtagataaacatagcaaactcaaactcattttaggaaaatcaagggtgcaaatagca |
11817139 |
T |
 |
| Q |
145 |
attctttccagtgaaattccccctcagtttttagaatgactt |
186 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11817138 |
atactttcaagtgaaattccccctcagtttttagaatgactt |
11817097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University