View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19349_low_8 (Length: 367)
Name: NF19349_low_8
Description: NF19349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19349_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 8229640 - 8229417
Alignment:
| Q |
17 |
atccattatccaatttcaaaatcactttgtttagaaaaatgtttcttgcacttcttttaattattattatttgtttttggtgaaaaatgcttccacttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8229640 |
atccattatccaatttcaaaatcactttgtttagaaaaatgtttcttgcacttcttttaattattatt---tgtttttggtgaaaaatgcttccacttat |
8229544 |
T |
|
| Q |
117 |
attctataataactcataaggctatagtgtataatacaacaaatcaagctgctgcagaagttggtaattttggctacatggttgcaagttgtaacatgca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8229543 |
attctataataactcataaggctatagtgtataatacaacaaatcaagctgctgcagaagttggtaattttggctacatggttgcaagttgtaacatgca |
8229444 |
T |
|
| Q |
217 |
agtgtttctcttggtcgacctaaaaca |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8229443 |
agtgtttctcttggtcgacctaaaaca |
8229417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 303 - 347
Target Start/End: Complemental strand, 8229356 - 8229312
Alignment:
| Q |
303 |
ctgtagtatctagaaatcacttttgtgtcaacaattttcttccca |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8229356 |
ctgtagtatctagaaatcacttttgtgtcaacaattttcttccca |
8229312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University