View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1934_high_10 (Length: 263)
Name: NF1934_high_10
Description: NF1934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1934_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 5706517 - 5706746
Alignment:
| Q |
17 |
gaagatgcataagaggaaaacagaaggtaaactgaattttttcgttctcaagctccaatttgctttaaccgttttcgctttcatctggattgtgctaccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5706517 |
gaagatgcataagaggaaaacagaaggtaaactgaattttttcgttctcaagctccaatttgctttaaccgttttcgctttcatctggattgtgctaccg |
5706616 |
T |
 |
| Q |
117 |
agagattttcggttttttctttcttcaatcaaatgcgctctgaatgaagcttaagaagttgatgattatggcgattctctttgtaacggatttttgttgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5706617 |
agagattttcggttttttctttcttcaatcaaatgcgctctgaatgaagcttaagaagttgatgattatggcgattctctttgtaacggatttttgttgg |
5706716 |
T |
 |
| Q |
217 |
ttcacgcagtgtgtgcccgcttaaattttt |
246 |
Q |
| |
|
||| ||| |||||||||||||||||||||| |
|
|
| T |
5706717 |
ttcgcgctgtgtgtgcccgcttaaattttt |
5706746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University