View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1934_high_16 (Length: 245)

Name: NF1934_high_16
Description: NF1934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1934_high_16
NF1934_high_16
[»] chr7 (1 HSPs)
chr7 (129-228)||(19503624-19503723)
[»] chr4 (1 HSPs)
chr4 (6-58)||(55989649-55989701)
[»] chr2 (1 HSPs)
chr2 (4-60)||(27909542-27909598)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 129 - 228
Target Start/End: Original strand, 19503624 - 19503723
Alignment:
129 acctcaaatttgaaatttagtttgatgagtattgctattttaaactagggtttataaatttaaagagaaattcttcttgtttatctactatcatttatat 228  Q
    |||||||| |||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
19503624 acctcaaagttgaaatttagtctgttgagtattgctattttaaactatggtttataaatttaaagagaaattcttcttgtttatctactatcatttatat 19503723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 58
Target Start/End: Complemental strand, 55989701 - 55989649
Alignment:
6 acctagtcgggatgtctaaacttcaccctgatgttttcttcactcttagttca 58  Q
    |||||||||||||||| || |||| || |||||| ||| ||||||||||||||    
55989701 acctagtcgggatgtcaaagcttctccttgatgtcttcctcactcttagttca 55989649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 60
Target Start/End: Original strand, 27909542 - 27909598
Alignment:
4 cgacctagtcgggatgtctaaacttcaccctgatgttttcttcactcttagttcatt 60  Q
    ||||||||||||||||||||| |||| || |||||| ||  || |||||||||||||    
27909542 cgacctagtcgggatgtctaagcttctccttgatgtctttctccctcttagttcatt 27909598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University