View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1934_low_16 (Length: 252)
Name: NF1934_low_16
Description: NF1934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1934_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 15 - 162
Target Start/End: Original strand, 19502971 - 19503118
Alignment:
| Q |
15 |
aaaggagtgtaaccctaacattatatttggtgatgccattctcgatccaagtaacattaagtttgagtttctgacaagagaggaagaaacttctttcgct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19502971 |
aaaggagtgtaaccctaacattatatttggtgatgccaatctcgacccaagtaacatgaagtttgagtttctgacaagagaggaagaaacttcttttgct |
19503070 |
T |
 |
| Q |
115 |
gaaatcattcctgacaatctcattcatggctatttggtaatttattaa |
162 |
Q |
| |
|
|||||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
19503071 |
gaaatcattcctaataatctcattcgtggctatttggtaatttattaa |
19503118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University