View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1934_low_17 (Length: 245)
Name: NF1934_low_17
Description: NF1934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1934_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 129 - 228
Target Start/End: Original strand, 19503624 - 19503723
Alignment:
| Q |
129 |
acctcaaatttgaaatttagtttgatgagtattgctattttaaactagggtttataaatttaaagagaaattcttcttgtttatctactatcatttatat |
228 |
Q |
| |
|
|||||||| |||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19503624 |
acctcaaagttgaaatttagtctgttgagtattgctattttaaactatggtttataaatttaaagagaaattcttcttgtttatctactatcatttatat |
19503723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 58
Target Start/End: Complemental strand, 55989701 - 55989649
Alignment:
| Q |
6 |
acctagtcgggatgtctaaacttcaccctgatgttttcttcactcttagttca |
58 |
Q |
| |
|
|||||||||||||||| || |||| || |||||| ||| |||||||||||||| |
|
|
| T |
55989701 |
acctagtcgggatgtcaaagcttctccttgatgtcttcctcactcttagttca |
55989649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 60
Target Start/End: Original strand, 27909542 - 27909598
Alignment:
| Q |
4 |
cgacctagtcgggatgtctaaacttcaccctgatgttttcttcactcttagttcatt |
60 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||| || || ||||||||||||| |
|
|
| T |
27909542 |
cgacctagtcgggatgtctaagcttctccttgatgtctttctccctcttagttcatt |
27909598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University