View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1934_low_7 (Length: 345)
Name: NF1934_low_7
Description: NF1934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1934_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 113 - 329
Target Start/End: Original strand, 8084977 - 8085195
Alignment:
| Q |
113 |
acattcaaagaatattataaaatattatatgttctattgttgagacagtccatgtcggttgggtgaagtggagtacacgtgaaggctacttccggttgca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8084977 |
acattcaaagaatattataaaatattatatgttctattg---agacaatccatgtcggttgggtgaagtggagtacacgtgaaggctacttccggttgca |
8085073 |
T |
|
| Q |
213 |
agaggtaagaaggtatgcatttcgaagtgaaacggaagatttgtttagtagcaaatgattagaaa-tttttgcacatt----gatagtgtaacaaacgtg |
307 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
8085074 |
agaggtaagaaggtatgcatttcaaagtgaaacggaagatttgtttagtagcaaatgattagaaattttttgcacattgatagatagtggaacaaacgtg |
8085173 |
T |
|
| Q |
308 |
gtaggatgtcattagcaaaatg |
329 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
8085174 |
gtaggatgtcatttgcaaaatg |
8085195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University