View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19350_high_6 (Length: 257)
Name: NF19350_high_6
Description: NF19350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19350_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 32 - 66
Target Start/End: Complemental strand, 1501073 - 1501039
Alignment:
| Q |
32 |
gaaaattataagaagtgaatttcaaatggtcaatc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1501073 |
gaaaattataagaagtgaatttcaaatggtcaatc |
1501039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University