View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19350_low_5 (Length: 302)
Name: NF19350_low_5
Description: NF19350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19350_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 16 - 145
Target Start/End: Original strand, 36465574 - 36465700
Alignment:
| Q |
16 |
attattcttcatgtatttcatgattgcattcacgcaatccaagtatagcttcgtatggtttcctacgattttataactannnnnnnnnnnaattgaaggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
36465574 |
attattcttcatgtatttcatgattgcattcacgcaatccaagtatagcttcgtatagtttcctacgattttataacta---ttttttttaattgaaggg |
36465670 |
T |
 |
| Q |
116 |
gttggtttttaattgggcatggattgtata |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36465671 |
gttggtttttaattgggcatggattgtata |
36465700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 145 - 184
Target Start/End: Original strand, 36465689 - 36465728
Alignment:
| Q |
145 |
atggattgtataagttcaccgtattcagaagctgttaaaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36465689 |
atggattgtataagttcaccgtattcagaagccgttaaaa |
36465728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University