View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19350_low_7 (Length: 264)
Name: NF19350_low_7
Description: NF19350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19350_low_7 |
 | |
|
| [»] scaffold0916 (1 HSPs) |
| | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 46159467 - 46159600
Alignment:
| Q |
17 |
aaggacaacatactgaaaatcaaacataaaatgaggaaaatgaagcttctgtttccacttatctatgattgattatgcatgttctgaaaagaggtgcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46159467 |
aaggacaacatactgaaaatcaaacataaaatgaggaaaatgaagcttctgtttcaactcatctatgattgattatgcatgttcagaaaagaggtgcaaa |
46159566 |
T |
|
| Q |
117 |
ggcctggggagccgagctagcatagtggtgcaaa |
150 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| |
|
|
| T |
46159567 |
ggcctgtggagctgagctagcatagtggtgcaaa |
46159600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 145 - 255
Target Start/End: Original strand, 46159679 - 46159789
Alignment:
| Q |
145 |
tgcaaactgtttgttactggggcgacaacccccgcagtactgctccagagtattgttgtaatccgaaccgtaactttctcgcttcttgctttagaaagat |
244 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46159679 |
tgcaaactgtttgttacgggggcgacaacccccgcagtactgctccagagtattgttgtaatccgaaccgtaactttctcgcttcttgctttagaaagat |
46159778 |
T |
|
| Q |
245 |
tgcagtattat |
255 |
Q |
| |
|
||||||||||| |
|
|
| T |
46159779 |
tgcagtattat |
46159789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 46159593 - 46159634
Alignment:
| Q |
109 |
ggtgcaaaggcctggggagccgagctagcatagtggtgcaaa |
150 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46159593 |
ggtgcaaaggcctggggagctgagctagcatagtggtgcaaa |
46159634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 68 - 140
Target Start/End: Original strand, 46166446 - 46166519
Alignment:
| Q |
68 |
tttccacttatctatgattgattatgcatgttc-tgaaaagaggtgcaaaggcctggggagccgagctagcata |
140 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||| | | |||||||| |||||||| ||||| || ||||||||||| |
|
|
| T |
46166446 |
tttcaactcatctatgattaattatgcatgtgcataaaaagaggggcaaaggcatggggggctgagctagcata |
46166519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0916 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0916
Description:
Target: scaffold0916; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 249
Target Start/End: Complemental strand, 2517 - 2484
Alignment:
| Q |
216 |
aactttctcgcttcttgctttagaaagattgcag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2517 |
aactttctcgcttcttgctttagaaagattgcag |
2484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 249
Target Start/End: Complemental strand, 49017 - 48984
Alignment:
| Q |
216 |
aactttctcgcttcttgctttagaaagattgcag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49017 |
aactttctcgcttcttgctttagaaagattgcag |
48984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University