View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19350_low_8 (Length: 257)

Name: NF19350_low_8
Description: NF19350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19350_low_8
NF19350_low_8
[»] chr6 (1 HSPs)
chr6 (32-66)||(1501039-1501073)


Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 32 - 66
Target Start/End: Complemental strand, 1501073 - 1501039
Alignment:
32 gaaaattataagaagtgaatttcaaatggtcaatc 66  Q
    |||||||||||||||||||||||||||||||||||    
1501073 gaaaattataagaagtgaatttcaaatggtcaatc 1501039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University