View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19351_high_3 (Length: 274)
Name: NF19351_high_3
Description: NF19351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19351_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 256
Target Start/End: Original strand, 40174192 - 40174436
Alignment:
| Q |
12 |
tatactactttcgacaaagaatccctgggtatgtattgcaggaaacctattttgctgaatatcttttgataggcatatatactgatgttgtgcaactatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174192 |
tatactactttcgacaaagaatccctgggtatgtattgcaggaaacctattttgctgaatatcttttgataggcatatatactgatgttgtgcaactatg |
40174291 |
T |
 |
| Q |
112 |
catatgcttttgtatagaactctatgctaaggcattacacaggttaccaagcatcagaattgcaggaatgtgttgagggattgcatttgttgtaccacaa |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
40174292 |
catatgctttggtatagaactctatgctaaggcattacacaggttaccaagcatcagaattgcgggaatgtgttgagggattgcatttgttgtaccgaaa |
40174391 |
T |
 |
| Q |
212 |
tggctatcatagttcaccttccattactgctatcagagagaaata |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174392 |
tggctatcatagttcaccttccattactgctatcagagagaaata |
40174436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University