View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19351_low_4 (Length: 250)
Name: NF19351_low_4
Description: NF19351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19351_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 34093759 - 34093983
Alignment:
| Q |
7 |
tcataatattgattttattttacagtggaaattgaaaaaggtaatggggaaagagaagtttccaaattagaaggcaccacatgggttcagcnnnnnnnnn |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34093759 |
tcataatattgattttattttacagtggaaattgaaaaaggtaatggggaaagagaagtttccaaattagaaggcaccacatgggttcagcttttatttt |
34093858 |
T |
|
| Q |
107 |
ncgtttaccaaaaatgaggatagaatagatagccatcattacaagtctattccatagggaagattcttatgattccaaatctcactccatatgattgtag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34093859 |
-cgtttaccaaaaatgaggatagaatagatagccatcattacaagtctattccatagggaagattcttatgattccaaatctcactccatatgattgtag |
34093957 |
T |
|
| Q |
207 |
aaaaaccgttttcaaaaccatttact |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34093958 |
aaaaaccgttttcaaaaccatttact |
34093983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University