View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19351_low_5 (Length: 237)
Name: NF19351_low_5
Description: NF19351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19351_low_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 25857064 - 25856845
Alignment:
| Q |
18 |
ataagatcataaattttattgcttcaccttctaatagcaacttgagtgtggaagaacctggtattcatgtaactatatcatcttctcctgagacaaaatt |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25857064 |
ataagatcataaattttattccttcaccttctaatagcaacttgagtgtggaagaacttggtattcatgtaactatatcatcttctcctgagacaaaatt |
25856965 |
T |
 |
| Q |
118 |
ttcgtatactcatgttgtaagcttctcttaaaaagaataagatcagaggttatttttgaaaatgttgccaaaggtctctttgttgaaagaaatagaatga |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25856964 |
ttggtatactcatgttgtaagcttctcttaaaaagaataagatcagaggttatttttgaaaatgttgccaaaggtctctttgttgaaagaaatagaatga |
25856865 |
T |
 |
| Q |
218 |
gcttgcacatgttcaaattt |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25856864 |
gcttgcacatgttcaaattt |
25856845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University