View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19351_low_7 (Length: 212)
Name: NF19351_low_7
Description: NF19351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19351_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 10 - 176
Target Start/End: Complemental strand, 7961172 - 7961006
Alignment:
| Q |
10 |
ctgatatgaagaaaaggggattcaaggttgatgggcagtgttattttacgttggtttattttctgtgtgagggtgatgagtttgagtgggctttggatat |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7961172 |
ctgatatgaagaaaaggggatttaaggttgatgggcagtgttattttacgttggtttattttctgtgtgagggtgatgagtttgagtgggctttggatat |
7961073 |
T |
 |
| Q |
110 |
tgctaaggagtgtattgctaaaggttgggttccaaattttactactatgaagaagcttgtgaatgga |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7961072 |
tgctaaggagtgtattgctaaaggttgggttccgaattttactactatgaagaagcttgtgaatgga |
7961006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University