View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19351_low_7 (Length: 212)

Name: NF19351_low_7
Description: NF19351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19351_low_7
NF19351_low_7
[»] chr2 (1 HSPs)
chr2 (10-176)||(7961006-7961172)


Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 10 - 176
Target Start/End: Complemental strand, 7961172 - 7961006
Alignment:
10 ctgatatgaagaaaaggggattcaaggttgatgggcagtgttattttacgttggtttattttctgtgtgagggtgatgagtttgagtgggctttggatat 109  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7961172 ctgatatgaagaaaaggggatttaaggttgatgggcagtgttattttacgttggtttattttctgtgtgagggtgatgagtttgagtgggctttggatat 7961073  T
110 tgctaaggagtgtattgctaaaggttgggttccaaattttactactatgaagaagcttgtgaatgga 176  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
7961072 tgctaaggagtgtattgctaaaggttgggttccgaattttactactatgaagaagcttgtgaatgga 7961006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University