View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19353_high_6 (Length: 236)
Name: NF19353_high_6
Description: NF19353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19353_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 82 - 221
Target Start/End: Complemental strand, 8786776 - 8786637
Alignment:
| Q |
82 |
tgaagttgacgaaaaagagagagtttggatcgaaaatgaaaaggatttgctgctgctgctgctaggttgagggatttcagtctgagggcagcaggaaatg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8786776 |
tgaagttgacgaaaaagagagagtttggatcgaaaatgataaggatttgctgctgctgctgctaggttgagggatttcagtctgagggcagcaggaaatg |
8786677 |
T |
 |
| Q |
182 |
gtaaatccatcgcttgacaatgctgctgctgctgcttctt |
221 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8786676 |
gtatgtccatcgcttgacaatgctgctgctgctgcttctt |
8786637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University