View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19353_low_4 (Length: 294)
Name: NF19353_low_4
Description: NF19353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19353_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 21 - 278
Target Start/End: Original strand, 43061873 - 43062130
Alignment:
| Q |
21 |
gtcttctctggcatccaatctcactcatcgtcttcgtcgttctcatagctgcgtggttgtttctctactttcttcgcgatgaacctattgttatctttgg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43061873 |
gtcttctctggcatccaatctcactcatcgtcttcgtcgttctcatagctgcgtggttgtttctctactttcttcgcgatgaacctattgttatctttgg |
43061972 |
T |
|
| Q |
121 |
acgactcatcagtgatcgtgttattcttgtgcttatgttgattctcaccgttggattgcttttgcttactggtgcgattctcaatattcttatcgccgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43061973 |
acgactcatcagtgatcgtgttattcttgtgcttatgttgattctcaccgttggattgcttttgcttactggtgcgattctcaatattcttatcgccgtt |
43062072 |
T |
|
| Q |
221 |
gcagttggtgttgttgttattcttcttcatgctgcttttagaaacaccagtgatctgt |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062073 |
gcagttggtgttgtagttattcttcttcatgctgcttttagaaacaccagtgatctgt |
43062130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 116 - 173
Target Start/End: Original strand, 43059652 - 43059709
Alignment:
| Q |
116 |
tttggacgactcatcagtgatcgtgttattcttgtgcttatgttgattctcaccgttg |
173 |
Q |
| |
|
|||||| |||||||||||||||||||| || || | | ||||||||||||||||||| |
|
|
| T |
43059652 |
tttggaagactcatcagtgatcgtgttgttgtttttccgatgttgattctcaccgttg |
43059709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University