View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19353_low_8 (Length: 246)
Name: NF19353_low_8
Description: NF19353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19353_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 2617633 - 2617413
Alignment:
| Q |
13 |
gaatatcaaccggccaacatctaacatcatcccctccatctctactaggtggaacaatagctatgattttctgcagcacatgcataggcagccaatcact |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||| |||||||| |
|
|
| T |
2617633 |
gaatatcacccggccaacatctaacatcatcccctccatctctactaggtggaacaatagctatgattt-ctgcaccatatgcataggcagacaatcact |
2617535 |
T |
 |
| Q |
113 |
cgtcatccgcaaattccactccccattgtcatcaactagatcaacaactctatcattacgcaaatcacttggaatgttgacctccaaaaca---acacaa |
209 |
Q |
| |
|
| || || ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| || |||||| |
|
|
| T |
2617534 |
catcgtcaacaaattccactccccgttgtcgtcaactagatcaacaactctatcattacgcaaatcactt-gaatgtcaacctccaaatcagctacacaa |
2617436 |
T |
 |
| Q |
210 |
agattacgagctatccaatttga |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2617435 |
agattacgagctatccaatttga |
2617413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 69 - 154
Target Start/End: Original strand, 42245484 - 42245573
Alignment:
| Q |
69 |
atagctatgattttctgcagcacat----gcataggcagccaatcactcgtcatccgcaaattccactccccattgtcatcaactagatc |
154 |
Q |
| |
|
|||| ||||||||||||||||| || | |||||||||||||||||| |||||| ||||||||||| ||| |||| |||||||||||| |
|
|
| T |
42245484 |
atagttatgattttctgcagcatatatatgtataggcagccaatcactcatcatccacaaattccacttcccgttgttatcaactagatc |
42245573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 5245030 - 5245078
Alignment:
| Q |
121 |
gcaaattccactccccattgtcatcaactagatcaacaactctatcatt |
169 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
5245030 |
gcaaattctactctccattagcatcaactagatcaacaactctagcatt |
5245078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University