View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19354_high_3 (Length: 325)
Name: NF19354_high_3
Description: NF19354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19354_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 140 - 315
Target Start/End: Original strand, 39042786 - 39042959
Alignment:
| Q |
140 |
aggcatagtggacttgttttagcaaggaacatgcaaaataaattgaattaatcatcttccgcttgtctaaaaaagatttaaatgccaaagaaatatatac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39042786 |
aggcatagtggacttgttttagcaaggaacatgcaaaataaattgaattaatcatcttccgcttgtctaaaagagatttaaatgccaaagaaatatatac |
39042885 |
T |
|
| Q |
240 |
acaagaacacgaatataatataaaatttaaaatctttttggtaaatactcatttcaaagtactttggttagtataa |
315 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39042886 |
acaagaacacg--gataatataaaatttaaaatctttttggtaaatactcatttcaaagtactttggttagtataa |
39042959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University