View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19356_low_3 (Length: 403)
Name: NF19356_low_3
Description: NF19356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19356_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 97 - 300
Target Start/End: Original strand, 34225255 - 34225458
Alignment:
| Q |
97 |
attaattttagtgaaatatatatcttgaattgcatggtggaaaagattaaagtttgcnnnnnnngttggttaaggaataaagatgattaatatatggttt |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34225255 |
attaattttagtgaaatttatatcttgaattgcatggtggaaaagattaaagtttgctttttttgttggttaaggaataaagattattaatatatggttt |
34225354 |
T |
|
| Q |
197 |
aattgtacttggtattactgcagacatatcctaatcctttgcaagacaaccctgcttactcagttgtaaagtgagtttgtttttctctctcttatttgtg |
296 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225355 |
aattgtacttggtgttactgcagacatatcctaatcctttgcaagacaaccctgcttactcagttgtaaagtgagtttgtttttctctctcttatttgtg |
34225454 |
T |
|
| Q |
297 |
tgat |
300 |
Q |
| |
|
|||| |
|
|
| T |
34225455 |
tgat |
34225458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 216 - 274
Target Start/End: Complemental strand, 42980718 - 42980660
Alignment:
| Q |
216 |
gcagacatatcctaatcctttgcaagacaaccctgcttactcagttgtaaagtgagttt |
274 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||| |||||||| |||| ||||| |
|
|
| T |
42980718 |
gcagacatattctaatccattgcaagacaatcctgcttattcagttgtcaagtaagttt |
42980660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University