View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19356_low_6 (Length: 256)
Name: NF19356_low_6
Description: NF19356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19356_low_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 36 - 256
Target Start/End: Complemental strand, 20417195 - 20416975
Alignment:
| Q |
36 |
ttactttatatatacactgttatgtacaccatagattgattgataattccaaattttcaatcgtattgtgttaatttccctcaaacaaaaattgttttgt |
135 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20417195 |
ttactttatatatacactattatatacaccatagattgattgataattccaaattttcaattgtattgtgttaatttccctcaaacaaaaattgttttgt |
20417096 |
T |
|
| Q |
136 |
gttaatgtgtgattcttcctcattgaaaatgtctccttcaccgattctacctcctgaactcatacaggaaatcctttcatggcttctgctggaacctctc |
235 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
20417095 |
gttaatgtgtgattcttcctcgttgataatgtctcctccaccgattctacctcctgaactcatacaggaaatcctttcatggcttccggtggaacctctc |
20416996 |
T |
|
| Q |
236 |
gtgagattcagttgcgtgtct |
256 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
20416995 |
gtgagattcagttgcgtgtct |
20416975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University