View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19357_low_8 (Length: 227)
Name: NF19357_low_8
Description: NF19357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19357_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 47637896 - 47637680
Alignment:
| Q |
11 |
caagtcaccatgatgaacaaatatcttaattagattgagattgattgattcagatgagtcaattttgatggcttgaaaatggtggattgagaaattgaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47637896 |
caagtcaccatgatgaacaaatatcttaattagattgagattgattgattcagatgagtcaattttgatggcttgaaaatggtggattgagaaattgaca |
47637797 |
T |
 |
| Q |
111 |
tagcaggaatagtgccaacataagacatgtttgtcttattttggatgaataagtatttaaggttttattttcttaacaaaaactcctattgttgagtgga |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47637796 |
tagcagggatagtgccaacataagacatgtttgtcttattttggatgaataagtatttaaggttttattttcttaacaaaaactcctattgttgagtgga |
47637697 |
T |
 |
| Q |
211 |
caaagtcttccataaat |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47637696 |
caaagtcttccataaat |
47637680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University