View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_101 (Length: 284)
Name: NF19358_high_101
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 52216241 - 52216508
Alignment:
| Q |
1 |
tcttgaattaccatattgacatctttcctctatccaattaaaaatgtctttgaatacaatctccagattttcaggtggctcaccatacaataaaccatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52216241 |
tcttgaattaccatattgacatctttcctctatccaattaaaaatgtctttgaatacaatctccaaattttcaggtggctcaccatacaataaaccatgc |
52216340 |
T |
 |
| Q |
101 |
cacattccagggtacaatttcagtgtcttatctttgcttgatgccacttcatgtaattgtttgctcactgatggatcagtcactctatcttcctcaccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52216341 |
cacattccagggtacaatttcagtgtcttatctttgcttgatgccacttcatgtaattgtttgctcactgatggatcagtcactctatcttcctcaccat |
52216440 |
T |
 |
| Q |
201 |
gtaaaatcaaaaaaggaagtgaaacttcatctagtgtttcctcaatttttgtagcaaccctgctaagt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52216441 |
gtaaaatcaaaaaaggaagtgaaacttcatctagtgtttcctcaatttttgtagcaaccctgctaagt |
52216508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 91 - 138
Target Start/End: Original strand, 44348019 - 44348066
Alignment:
| Q |
91 |
taaaccatgccacattccagggtacaatttcagtgtcttatctttgct |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
44348019 |
taaaccatgccacattccagggtacaatttaattgtcttatctttgct |
44348066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University