View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_135 (Length: 246)
Name: NF19358_high_135
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_135 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 1109887 - 1109660
Alignment:
| Q |
1 |
ttggtcctccctaaactaagtttctggctttgtccctatgtagaaggtggacaaatacatgtagaggaagatatgatgtgtgaagagctgacttttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109887 |
ttggtcctccctaaactaagtttctggctttgtccctatgtagaaggtggacaaatacatgt-gaggaagatatgatgtgtgaagagctgacttttttat |
1109789 |
T |
|
| Q |
101 |
tacaacatgttaatgatgtattttagatgatgtattttggatcacttgtctttgtgatgtattttggtgatgtgttttttatgaattgtcttgacgatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1109788 |
tacaacatgttaatgatgtattttagatgatgtattttggatcacttgtctttgtgatgtatttttgtgatgtgttttttatgaattgtcttgacgatgt |
1109689 |
T |
|
| Q |
201 |
atc--ttggttatatattatggatggaac |
227 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
1109688 |
atcttttggttatatattatggatggaac |
1109660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University