View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19358_high_144 (Length: 239)

Name: NF19358_high_144
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19358_high_144
NF19358_high_144
[»] chr1 (1 HSPs)
chr1 (15-220)||(52246888-52247095)
[»] chr5 (1 HSPs)
chr5 (60-107)||(12618416-12618463)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 52246888 - 52247095
Alignment:
15 aatactattgccatgtaaatggtttcccttttgcttttttgatatatagaaaacaaattcgatactttgagatttacaacactcacaaacac--taatga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||     
52246888 aatactattgccatgtaaatggtttcccttttgcttttttgatatatagaaaacaaattcgatactttgagatttacaacactcacaaacacactaatgg 52246987  T
113 taacnnnnnnnncatgcaaatggtttttatttgaaattttagaatgagaactaataatataatttagatgcaatatatgtttgagaaagtagaaaggaga 212  Q
    ||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52246988 taacaaaaaaaacatgcaaatggtttttatttgaaattttagaatgagaactaataatataatttagatgcaatatatgtttgagaaagtagaaaggaga 52247087  T
213 aagaaatt 220  Q
    ||||||||    
52247088 aagaaatt 52247095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 107
Target Start/End: Original strand, 12618416 - 12618463
Alignment:
60 atagaaaacaaattcgatactttgagatttacaacactcacaaacact 107  Q
    ||||||| |||| |||||||| |||||||||||||||||||| |||||    
12618416 atagaaatcaaactcgatactatgagatttacaacactcacagacact 12618463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University