View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_155 (Length: 227)
Name: NF19358_high_155
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_155 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 85 - 212
Target Start/End: Original strand, 30692755 - 30692882
Alignment:
| Q |
85 |
caataaattccaacctttgatgtcagttaatttttagataaaacacttttaaaaacataatgcttcagtgtcattgatacaaatcccatagattatcacc |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30692755 |
caataaattccaacctttgatatcagttaatttttagataaaacacttttaaaaacataatgcttcagtgtcattgatacaaatcccatagattatcacc |
30692854 |
T |
|
| Q |
185 |
tggaaagtgaaattatcactcttgttat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30692855 |
tggaaagtgaaattatcactcttgttat |
30692882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 30692655 - 30692726
Alignment:
| Q |
1 |
acacgagtatgttgactaatgaagtgattaaacaaaaggttccttttcttttgcaaaatcactcttgaagcc |
72 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30692655 |
acactagtatgttgactaatgaagtgattaaacaaaaggttccttttctttcgcaaaatcactcttgaagcc |
30692726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University