View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_158 (Length: 224)
Name: NF19358_high_158
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_158 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 2308752 - 2308945
Alignment:
| Q |
14 |
aatatatatacttttttgtgtatattcgagtctggagggagtatcacacattggtagtttttattgtatacaaaatgtg-ttttttgcgacaaaatttgt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
2308752 |
aatatatatacttttttgtgtatattcgagtctggagggagtatcacacggtggtagtttttattgtatacaaaatgtggttttttgtgacaaaatttgt |
2308851 |
T |
 |
| Q |
113 |
aatgcggacaaagagattgggggatcaaatgttggaaggaaatgcattctctcctttcaaaaaccctaagcaaataatgtgaagatcttatatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2308852 |
tatgcggacaaagagattgggggatcaaatgttggaaggaaatgcattctctcctttgaaaaaccctaagcaaataatgtggagatcttatatc |
2308945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University