View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_162 (Length: 220)
Name: NF19358_high_162
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_162 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 40 - 213
Target Start/End: Complemental strand, 39234103 - 39233928
Alignment:
| Q |
40 |
attttgaaaactatatttttcaaaatgaaattcaagtttttaagttgtggttgcattgcgatccttgattacgaatataattatggtcaaatgaagctaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39234103 |
attttgaaaactatatttttcaaaattaaattcaagtttttatgttgtggttgcattgcgatccttgattacgaggataattatggtcaaatgaagctaa |
39234004 |
T |
 |
| Q |
140 |
taatgccttaatcccagatcaaaaaattattgtaaactgctgggtataa--gtgtagacatttttcggtttctgtg |
213 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39234003 |
tgatgccttaatcccagatcaaaaaattattgtaaactgctgggtataagtgtgtagacatttttcggtttctgtg |
39233928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University