View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_163 (Length: 219)
Name: NF19358_high_163
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_163 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 219
Target Start/End: Original strand, 55303182 - 55303394
Alignment:
| Q |
7 |
gagagatgaaccatattatctacccaagttaggaattgtaagtaggcatataagctcttaagtcttaacaatataatgaaagaaactttaaatattgcct |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55303182 |
gagatatgaaccatattatctacccaagttaggaattgtaagtaggcatataagctcttaagtcttaacaatataatgaaagaaactttaaatattgcct |
55303281 |
T |
 |
| Q |
107 |
gtctctctcctttgacatggatagggagaaatggtcgaaaatctcaaactgcgtgtgcagaaatcactccatcatgttgaggtaaatctcacagaagcaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55303282 |
gtctctctcctttgacatggatagggagaaatggtcgaaaatctcaaactgcgtgtgcagaaatcactccatcatgttgaggtaaatctctcagaagcaa |
55303381 |
T |
 |
| Q |
207 |
agggatatgaaaa |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
55303382 |
agggatatgaaaa |
55303394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University