View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_167 (Length: 216)
Name: NF19358_high_167
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_167 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 121 - 198
Target Start/End: Complemental strand, 13775766 - 13775689
Alignment:
| Q |
121 |
ttcaatctgtggacaatgattatgcctccaaaatgctagttcatgcgacacaagtatagttttatgttttgttatatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13775766 |
ttcaatctgtggacaatgattatgcctccaaaatgctagttcatgcgacacaagtatagttttatgttttgttatatc |
13775689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 13775869 - 13775824
Alignment:
| Q |
18 |
gatatgtcaacacctagaaattcttataagattgatgaacaacatc |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13775869 |
gatatgtcaacacctagaaattcttataagattgatgaacaacatc |
13775824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 13765253 - 13765208
Alignment:
| Q |
18 |
gatatgtcaacacctagaaattcttataagattgatgaacaacatc |
63 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
13765253 |
gatatgtcaacacctagaaattcgtataagattgatgaagaacatc |
13765208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University