View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_171 (Length: 205)
Name: NF19358_high_171
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_171 |
 |  |
|
| [»] scaffold0074 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 8696618 - 8696788
Alignment:
| Q |
17 |
agatttttggcttatcctttactttgaatattcatttagaaaggttataataatgaatgtattgcaggtgtgactaataactaactactagagaagcctc |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8696618 |
agatttttggcatatcctttactttgaatattcatttagaaaggttataataatgaatgtattacaggtgtgactaataactaactactagagaagcctc |
8696717 |
T |
 |
| Q |
117 |
gtaaaaaagggannnnnnnnctatcatctctttagataaatggttgcttctatgatgtcatgatgcacaggtt |
189 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8696718 |
ataaaaaagtga--tttttgctatcatctctttagataaatggttgcttctatgatgtcatgatgcacaggtt |
8696788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0074 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: scaffold0074
Description:
Target: scaffold0074; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 19347 - 19517
Alignment:
| Q |
17 |
agatttttggcttatcctttactttgaatattcatttagaaaggttataataatgaatgtattgcaggtgtgactaataactaactactagagaagcctc |
116 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19347 |
agatttttggcatatcctttactatgaatattcatttagaaaggttataataatgaatgtattacagatgtgactaataactaactactagagaagcctc |
19446 |
T |
 |
| Q |
117 |
gtaaaaaagggannnnnnnnctatcatctctttagataaatggttgcttctatgatgtcatgatgcacaggtt |
189 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19447 |
ataaaaaagtga--tttttgctatcatctctttagataaatggttgcttctatgatgtcatgatgcacaggtt |
19517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University