View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_173 (Length: 202)
Name: NF19358_high_173
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_173 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 82 - 183
Target Start/End: Original strand, 5576236 - 5576337
Alignment:
| Q |
82 |
agacaattatgcagaaatcaaatcataaaaacctgttactatacaaacagccccaaacaatggtcttgcactgtatcgtcttctctcatggagcttccac |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5576236 |
agacaattatgcagaagtcaaatcataaaaacctgttactatacaaacagccccaaacaatagtcttgcactgtatcgtcttctctcatggagcttccac |
5576335 |
T |
 |
| Q |
182 |
tt |
183 |
Q |
| |
|
|| |
|
|
| T |
5576336 |
tt |
5576337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University