View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_25 (Length: 462)
Name: NF19358_high_25
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 2e-38; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 171 - 308
Target Start/End: Complemental strand, 44646828 - 44646690
Alignment:
| Q |
171 |
tatcaaatttttgttcacctcaaaaaagttgttttgatccctctaaaaaa-tttgnnnnnnnngccaatattctgattttactcaannnnnnnaatcact |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
44646828 |
tatcaaatttttgttcacctcaaaaaagttgttttgatccctctaaaaaaatttgttttttttgccaatattctgattttactcaatttttttaatcact |
44646729 |
T |
 |
| Q |
270 |
gttatttataaaagtttatgtttcttgtttcaaacgata |
308 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44646728 |
gttatttataaaagttcatgtttcttgtttcaaacgata |
44646690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 44646973 - 44646921
Alignment:
| Q |
16 |
ataatacagaatta-agcaatacagataccgtccaacacttaaatacaactgg |
67 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44646973 |
ataatacagaattacagcaatacagataccgtccaacacttaaatacaactgg |
44646921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 179
Target Start/End: Complemental strand, 44646866 - 44646830
Alignment:
| Q |
143 |
ggtacaagggtcaaatatgattttagtctatcaaatt |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44646866 |
ggtacaagggtcaaatatgattttggtctatcaaatt |
44646830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University