View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_39 (Length: 421)
Name: NF19358_high_39
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_39 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 5e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 259 - 421
Target Start/End: Original strand, 51265177 - 51265339
Alignment:
| Q |
259 |
agaatcgtcactaatagtattgaatgtcagtatcaagtctaaaagttcttgatctgcagttgagtgttctgcagtgttttctgtcctagccctccgtctt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51265177 |
agaatcgtcactaatagtattgaatgtcagtatcaagtctaaaagttcttgatctgcagttgagtgttctacagtgttttctgtcctagccctccgtctt |
51265276 |
T |
|
| Q |
359 |
ggaagtgaaaacagttgcaacatcaggtcttctcgagaagttatctggtacattcagccccta |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
51265277 |
ggaagtgaaaacagttgcaacatcaggtcttcctgagaagctatctggtacatccagccccta |
51265339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University