View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_66 (Length: 341)
Name: NF19358_high_66
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 13219678 - 13219389
Alignment:
| Q |
18 |
atagttcactatctacatgaaatataactaacttcataaacaattattgattaaattg-------aatacgcctgttcctcgttgaattttgcccaatca |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
13219678 |
atagttcactatctacatgaaata--actaacttcataaacaattattgattaaattattgtttaaatacgtctgttcctcgttgaattttgcccaatca |
13219581 |
T |
 |
| Q |
111 |
atca-tttcaccatcaaattttatcgaaatggttaaattaacacccctcgaattattgactaaattatagtatggtatgggaatgggatacactttttta |
209 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13219580 |
atcaatttcaccatcaaatttgatcgaaatagttaaa---acatccctcgaattattgactaaattatagtatggtatggga------tacactttttta |
13219490 |
T |
 |
| Q |
210 |
acgtgtattttgttaatcatatactattatacactattagtatgccttatttttatgaaatatttttggtttaacacaatcattttccgtgaagagacac |
309 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13219489 |
acgtgtattttgtcaatcatatactattatacactattagtatgccttatttttatgaaatatttttggtttaacacaatcattttccgtgaagagacac |
13219390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University