View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_78 (Length: 321)
Name: NF19358_high_78
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 22 - 306
Target Start/End: Original strand, 10469955 - 10470239
Alignment:
| Q |
22 |
tcgaagaaaaaatgaatgtgatgaatttcacgaacctttgatcatagatgttgaagcgagcattgctataatcagaaaagcacgttttgagattatgttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10469955 |
tcgaagaaaaaatgaatgtgatgaatttcacgaacctttgatcatagatgttgaagcgagcattgctataatcagaaaagcacgttttgagattatgttg |
10470054 |
T |
|
| Q |
122 |
atcagcgagttcccaaacaggattaacttcacgacctccaacaccggcgatccaaccagcaccgagttccaccgacacgccaccgaaacattccttccgg |
221 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10470055 |
aacagcgagttcccaaacaggattagcttcacgacctccaacaccggcgatccaaccagcaccgagttccaccgacacgccaccgaaacattccttacgg |
10470154 |
T |
|
| Q |
222 |
atcctgccgccgattctgtccgacgcttccaggatcactatgtcttccacgccgttctcagctaacactttcgccgcagagatac |
306 |
Q |
| |
|
|||||||||||||||| |||||||||||| || |||||||||||||| ||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
10470155 |
atcctgccgccgattcggtccgacgcttcaagcatcactatgtcttctacgccgttctcagataacactttcgccgcggagatac |
10470239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University