View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_high_88 (Length: 302)
Name: NF19358_high_88
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_high_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 28382090 - 28381815
Alignment:
| Q |
19 |
gcaccgacaccagaaggaatg-gcaaatcacaaatttttgcaactatataaaattaaagtggttgtcacgtagcataactcttaattactaatgcaaacg |
117 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28382090 |
gcaccgacaccagaaggaatatgctaatcacaaatttttgcaactatataaaattaaagtggttgtcacgtagcataactcttaattactaatgcaaacg |
28381991 |
T |
 |
| Q |
118 |
tgttttaagtggttggaggaaatgagaaggaaacccactatggaaactggaaatgatgcaagagggcaagtagagtaacatacttttactaataataatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381990 |
tgttttaagtggttggaggaaatgagaaggaaacccactatggaaattggaaatgatgcaagagggcaagtagagtaacatacttttactaataataatc |
28381891 |
T |
 |
| Q |
218 |
aagggctgctcaaaataataatcataaagatgtgagcatttatggcc-ttggtgaggtcttggataggttttgatg |
292 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||| ||||||||| | ||||||| |
|
|
| T |
28381890 |
aagggctgctcaaaataataaacataaagatgtgaccatttatggcctttggtgagatcttggatatgctttgatg |
28381815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University