View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_101 (Length: 289)
Name: NF19358_low_101
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_101 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 3 - 266
Target Start/End: Original strand, 6852389 - 6852651
Alignment:
| Q |
3 |
tatttctttaggattagtataagggcaattatggcaggacactccaaatcactttaggattttactatttttacttgcaaagacacaagtataactctgc |
102 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6852389 |
tatttctttaggattagtataagagcaaatatggcgggacactccaaatcattttaggattttactatttttacttgcaaagacataagtataactctgc |
6852488 |
T |
 |
| Q |
103 |
ataatattttgctatttttgcatatgatagttgaaagttttctctttatttttatgataaatatttacattggtttcatctatggtagttctaaaatagt |
202 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||| ||| ||||||| | ||| ||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
6852489 |
acaatattttgctatatttgcatatgatagttggaag-tttctctctttttatatgataaatatttacattggtttcatctatggtaattctaaaacagt |
6852587 |
T |
 |
| Q |
203 |
actatttcaaattgttagcttctaatgttgagataattatatggtaactttgttggtaaacctc |
266 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6852588 |
actatttcaaattgatagcttctaatgttgagataattatatggtaaatttgttggtaaacctc |
6852651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 41 - 149
Target Start/End: Original strand, 18743852 - 18743960
Alignment:
| Q |
41 |
acactccaaatcactttaggattttactatttttacttgcaaagacacaagtataactctgcataatattttgctatttttgcatatgatagttgaaagt |
140 |
Q |
| |
|
||||| ||| ||| ||||||||||||||| |||||||| ||||| || || ||||| |||||| ||||||||||| | || ||||| ||||||||||||| |
|
|
| T |
18743852 |
acactgcaagtcattttaggattttactacttttacttacaaaggcaaaaatataattctgcacaatattttgctttcttcgcatacgatagttgaaagt |
18743951 |
T |
 |
| Q |
141 |
tttctcttt |
149 |
Q |
| |
|
||||||||| |
|
|
| T |
18743952 |
tttctcttt |
18743960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University