View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_121 (Length: 258)
Name: NF19358_low_121
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_121 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 40308383 - 40308157
Alignment:
| Q |
17 |
attgtgtgtaagcgaaacaaacccctcacagtttatgtttttcccctcaaattttatttttacatcgtttatcttaaaatcattggagtgattgggtata |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40308383 |
attgtgtgtaagcggaacaaacccctcatagtttatgtttttcccctcaaattttatttttacattgtttatcttaaaatcattggagtgattgggtata |
40308284 |
T |
|
| Q |
117 |
tccactannnnnnnngttaatgttgaaaaatgtagaagtgcttcaattgtggcaggaaaaacgttattcataaggtgtcggagagacaaaactcaagttg |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40308283 |
tccactattttttttgttaatgttgaaaaatgtagaagtgcttcaattgtggcaggaaaaacgttattcataaggtgtcggagagacaaaactcaagttg |
40308184 |
T |
|
| Q |
217 |
aacttttattgtgattgtgatgttact |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40308183 |
aacttttattgtgattgtgatgttact |
40308157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University