View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_128 (Length: 254)
Name: NF19358_low_128
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 52405585 - 52405815
Alignment:
| Q |
7 |
tcgaaaaaacttttcttctagaggataaacttctcaaggatattgcagaggctccttttccaatcaatgtggtattatcgatcaaccactcggtgtttgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52405585 |
tcgaaaaaacttttcttctagaggataaacttctcaaggatattgcagaggctccttttccaatcaatgtggtattatcgatcaaccactcggtgtttgt |
52405684 |
T |
 |
| Q |
107 |
gaaaggtgaccacacaaactttgtgattgagccttcttttggggttgaggcttatgagttgtacccagatgtcaagtacacaactgtggaggaatacctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52405685 |
gaaaggtgaccacacaaactttgtgattgagccttcttttggggttgaggcttatgagttgtacccagatgtcaagtacacaactgtggaggaatacctt |
52405784 |
T |
 |
| Q |
207 |
gatcagttcgtttgaagaattaacaaaatct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52405785 |
gatcagttcgtttgaagaattaacaaaatct |
52405815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 93 - 221
Target Start/End: Original strand, 52408338 - 52408466
Alignment:
| Q |
93 |
cactcggtgtttgtgaaaggtgaccacacaaactttgtgattgagccttcttttggggttgaggcttatgagttgtacccagatgtcaagtacacaactg |
192 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | || ||||| |||||||| ||||| ||| |
|
|
| T |
52408338 |
cactcagtgtttgtgaaaggtgaccacacaaactttgagattgagccttcttttggggttgaggcttccgctttatacccggatgtcaactacaccactc |
52408437 |
T |
 |
| Q |
193 |
tggaggaataccttgatcagttcgtttga |
221 |
Q |
| |
|
||||||||| |||||||| ||| ||||| |
|
|
| T |
52408438 |
tggaggaatgtcttgatcacttcatttga |
52408466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University