View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_131 (Length: 250)
Name: NF19358_low_131
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_131 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 36383197 - 36383431
Alignment:
| Q |
1 |
gttattggtattactcaaatgtgaattctaaccactataatacttgatnnnnnnntgttgcatccgttgatccaaaagatgacataatattgaatgatgg |
100 |
Q |
| |
|
|||||||| | |||| ||||||||||| |||| |||||| |||||||| ||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36383197 |
gttattggcactacttaaatgtgaattttaactactatactacttgataaaaaa-tgttggatcggttgatccaaaagatgacataatattgaatgatgg |
36383295 |
T |
|
| Q |
101 |
gtgttttcaaccaaatgtcatggatacattgtgttcatatataatttataagtactttttagttggacattattcttcaactacatttgaagttctaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36383296 |
gtgttttcaaccaaatgtcatggatacattgtgttcata----atttataagtactttttagttggacattattcttcaactacatttgaagttctaaag |
36383391 |
T |
|
| Q |
201 |
agcatttgaagtagtattgacttgctcatgccaacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36383392 |
agcatttgaagtagtattgacttgctcatgccaacctatg |
36383431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University