View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19358_low_141 (Length: 242)
Name: NF19358_low_141
Description: NF19358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19358_low_141 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 32885379 - 32885580
Alignment:
| Q |
18 |
atatctttcatttcttaatttcnnnnnnnagatacaatatgatattttatgatgaatacagtgttatccaaattgacatcagatataatagaatctaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
32885379 |
atatctttcatttcttaatttctttttttagatataatatgatattttatgatgaatacagtgttatccaaattgacatcagatagaatggaatctaaaa |
32885478 |
T |
|
| Q |
118 |
ctttgagagtatattctaaatcttaagtccgtgtcaccagaccaacctaagtaagttactatcaccaaatattcaataactgtgaatgaatttatgtaaa |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
32885479 |
ctttgaaagtatattctaaatcttaagtcagtgt---cagaccaacctaagtaagttactatcaccaaatattcaataactgtgaataaatttatgtaca |
32885575 |
T |
|
| Q |
218 |
aagta |
222 |
Q |
| |
|
||||| |
|
|
| T |
32885576 |
aagta |
32885580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 83 - 124
Target Start/End: Complemental strand, 17780912 - 17780871
Alignment:
| Q |
83 |
atccaaattgacatcagatataatagaatctaaaactttgag |
124 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
17780912 |
atccaaattgacatcagaaacaatcgaatctaaaactttgag |
17780871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University